




pCambia 1305.2载体基本信息

载体名称:pCambia1305.2, pCambia 1305.2
载体大小:11922 bp
5' 测序引物及序列:35S promoter: CTATCCTTCGCAAGACCCTTC
3' 测序引物及序列:--

pCambia 1305.2载体质粒图谱和多克隆位点信息


pCambia 1305.2载体序列

LOCUS       pCAMBIA1305.2          11922 bp ds-DNA    circular SYN  
DEFINITION  Agrobacterium binary vector for plant transformation, with 
            hygromycin- and kanamycin-resistance and secreted GUSPlus(TM) genes.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
COMMENT     This file is created by Vector NTI
COMMENT     The GenBank record was corrected by inserting a G at position 4815.
FEATURES             Location/Qualifiers
     source          1..11922
                     /organism="synthetic DNA construct"
                     /lab_host="Plant Cells"
                     /mol_type="other DNA"
     CDS             2..82
                     /product="signal sequence from?Oryza sativa glycine-rich 
                     cell wall protein"
                     /label="GRP signal sequence"
     CDS             join(83..91,282..2099)
                     /label="codon-optimized Staphylococcus gusA?gene?with a 
                     catalase intron to ensure expression in plants but not 
     intron          92..281
                     /label="cat1 intron"
                     /label="castor bean catalase intron, modified"
     CDS             2106..2123
                     /product="6xHis affinity tag"
     terminator      2155..2407
                     /label="NOS terminator"
                     /label="nopaline synthase terminator and poly(A) signal"
     misc_feature    2429..2453
                     /label="RB T-DNA repeat"
                     /label="right border repeat from nopaline C58 T-DNA"
     CDS             3753..4382
                     /product="stability protein from Pseudomonas plasmid pVS1"
                     /label="pVS1 StaA"
     CDS             4811..5884
                     /product="replication protein from Pseudomonas plasmid 
                     /label="pVS1 RepA"
     misc_feature    6488..6628
                     /label="basis of mobility region from pBR322"
     rep_origin      complement(6814..7402)
                     /label="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(7489..8283)
                     /product="aminoglycoside phosphotransferase"
                     /label="confers resistance to kanamycin"
     misc_feature    8708..8732
                     /label="LB T-DNA repeat"
                     /label="left border repeat from nopaline C58 T-DNA"
     polyA_signal    8810..8984
                     /label="CaMV poly(A) signal"
                     /label="cauliflower mosaic virus polyadenylation signal"
     CDS             complement(9024..10049)
                     /product="hygromycin B phosphotransferase"
                     /label="confers resistance to hygromycin"
     promoter        complement(10117..10794)
                     /label="CaMV 35S promoter (enhanced)"
                     /label="cauliflower mosaic virus 35S promoter with a 
                     duplicated enhancer region"
     promoter        11021..11051
                     /label="lac promoter"
                     /label="promoter for the E. coli lac operon"
     protein_bind    11059..11075
                     /bound_moiety="lac repressor encoded by lacI"
                     /label="lac operator"
                     /label="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     11083..11099
                     /label="M13 rev"
                     /label="common sequencing primer, one of multiple similar 
     CDS             11095..11328
                     /gene="lacZ (truncated)"
                     /product="LacZ-alpha fragment of?beta-galactosidase"
     misc_feature    11109..11165
                     /label="pUC18/19 multiple cloning site"
     primer_bind     complement(11169..11185)
                     /label="M13 fwd"
                     /label="common sequencing primer, one of multiple similar 
     promoter        11562..11907
                     /label="CaMV 35S promoter"
                     /label="strong constitutive promoter from cauliflower mosaic
        1 catggctact actaagcatt tggctcttgc catccttgtc ctccttagca ttggtatgac
       61 caccagtgca agaaccctcc tagatctgag ggtaaatttc tagtttttct ccttcatttt
      121 cttggttagg acccttttct ctttttattt ttttgagctt tgatctttct ttaaactgat
      181 ctatttttta attgattggt tatggtgtaa atattacata gctttaactg ataatctgat
      241 tactttattt cgtgtgtcta tgatgatgat gatagttaca gaaccgacga actagtctgt
      301 acccgatcaa caccgagacc cgtggcgtct tcgacctcaa tggcgtctgg aacttcaagc
      361 tggactacgg gaaaggactg gaagagaagt ggtacgaaag caagctgacc gacactatta
      421 gtatggccgt cccaagcagt tacaatgaca ttggcgtgac caaggaaatc cgcaaccata
      481 tcggatatgt ctggtacgaa cgtgagttca cggtgccggc ctatctgaag gatcagcgta
      541 tcgtgctccg cttcggctct gcaactcaca aagcaattgt ctatgtcaat ggtgagctgg
      601 tcgtggagca caagggcgga ttcctgccat tcgaagcgga aatcaacaac tcgctgcgtg
      661 atggcatgaa tcgcgtcacc gtcgccgtgg acaacatcct cgacgatagc accctcccgg
      721 tggggctgta cagcgagcgc cacgaagagg gcctcggaaa agtcattcgt aacaagccga
      781 acttcgactt cttcaactat gcaggcctgc accgtccggt gaaaatctac acgaccccgt
      841 ttacgtacgt cgaggacatc tcggttgtga ccgacttcaa tggcccaacc gggactgtga
      901 cctatacggt ggactttcaa ggcaaagccg agaccgtgaa agtgtcggtc gtggatgagg
      961 aaggcaaagt ggtcgcaagc accgagggcc tgagcggtaa cgtggagatt ccgaatgtca
     1021 tcctctggga accactgaac acgtatctct accagatcaa agtggaactg gtgaacgacg
     1081 gactgaccat cgatgtctat gaagagccgt tcggcgtgcg gaccgtggaa gtcaacgacg
     1141 gcaagttcct catcaacaac aaaccgttct acttcaaggg ctttggcaaa catgaggaca
     1201 ctcctatcaa cggccgtggc tttaacgaag cgagcaatgt gatggatttc aatatcctca
     1261 aatggatcgg cgccaacagc ttccggaccg cacactatcc gtactctgaa gagttgatgc
     1321 gtcttgcgga tcgcgagggt ctggtcgtga tcgacgagac tccggcagtt ggcgtgcacc
     1381 tcaacttcat ggccaccacg ggactcggcg aaggcagcga gcgcgtcagt acctgggaga
     1441 agattcggac gtttgagcac catcaagacg ttctccgtga actggtgtct cgtgacaaga
     1501 accatccaag cgtcgtgatg tggagcatcg ccaacgaggc ggcgactgag gaagagggcg
     1561 cgtacgagta cttcaagccg ttggtggagc tgaccaagga actcgaccca cagaagcgtc
     1621 cggtcacgat cgtgctgttt gtgatggcta ccccggagac ggacaaagtc gccgaactga
     1681 ttgacgtcat cgcgctcaat cgctataacg gatggtactt cgatggcggt gatctcgaag
     1741 cggccaaagt ccatctccgc caggaatttc acgcgtggaa caagcgttgc ccaggaaagc
     1801 cgatcatgat cactgagtac ggcgcagaca ccgttgcggg ctttcacgac attgatccag
     1861 tgatgttcac cgaggaatat caagtcgagt actaccaggc gaaccacgtc gtgttcgatg
     1921 agtttgagaa cttcgtgggt gagcaagcgt ggaacttcgc ggacttcgcg acctctcagg
     1981 gcgtgatgcg cgtccaagga aacaagaagg gcgtgttcac tcgtgaccgc aagccgaagc
     2041 tcgccgcgca cgtctttcgc gagcgctgga ccaacattcc agatttcggc tacaagaacg
     2101 ctagccatca ccatcaccat cacgtgtgaa ttggtgacca gctcgaattt ccccgatcgt
     2161 tcaaacattt ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt
     2221 atcatataat ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg
     2281 ttatttatga gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata
     2341 gaaaacaaaa tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta
     2401 ctagatcggg aattaaacta tcagtgtttg acaggatata ttggcgggta aacctaagag
     2461 aaaagagcgt ttattagaat aacggatatt taaaagggcg tgaaaaggtt tatccgttcg
     2521 tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg gatcaaagta ctttgatcca
     2581 acccctccgc tgctatagtg cagtcggctt ctgacgttca gtgcagccgt cttctgaaaa
     2641 cgacatgtcg cacaagtcct aagttacgcg acaggctgcc gccctgccct tttcctggcg
     2701 ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact tgcgactaga accggagaca
     2761 ttacgccatg aacaagagcg ccgccgctgg cctgctgggc tatgcccgcg tcagcaccga
     2821 cgaccaggac ttgaccaacc aacgggccga actgcacgcg gccggctgca ccaagctgtt
     2881 ttccgagaag atcaccggca ccaggcgcga ccgcccggag ctggccagga tgcttgacca
     2941 cctacgccct ggcgacgttg tgacagtgac caggctagac cgcctggccc gcagcacccg
     3001 cgacctactg gacattgccg agcgcatcca ggaggccggc gcgggcctgc gtagcctggc
     3061 agagccgtgg gccgacacca ccacgccggc cggccgcatg gtgttgaccg tgttcgccgg
     3121 cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc cggagcgggc gcgaggccgc
     3181 caaggcccga ggcgtgaagt ttggcccccg ccctaccctc accccggcac agatcgcgca
     3241 cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa gaggcggctg cactgcttgg
     3301 cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc gaggaagtga cgcccaccga
     3361 ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc gaggccgacg ccctggcggc
     3421 cgccgagaat gaacgccaag aggaacaagc atgaaaccgc accaggacgg ccaggacgaa
     3481 ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg cggccgggta cgtgttcgag
     3541 ccgcccgcgc acgtctcaac cgtgcggctg catgaaatcc tggccggttt gtctgatgcc
     3601 aagctggcgg cctggccggc cagcttggcc gctgaagaaa ccgagcgccg ccgtctaaaa
     3661 aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg tcgctgcgta tatgatgcga
     3721 tgagtaaata aacaaatacg caaggggaac gcatgaaggt tatcgctgta cttaaccaga
     3781 aaggcgggtc aggcaagacg accatcgcaa cccatctagc ccgcgccctg caactcgccg
     3841 gggccgatgt tctgttagtc gattccgatc cccagggcag tgcccgcgat tgggcggccg
     3901 tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg cccgacgatt gaccgcgacg
     3961 tgaaggccat cggccggcgc gacttcgtag tgatcgacgg agcgccccag gcggcggact
     4021 tggctgtgtc cgcgatcaag gcagccgact tcgtgctgat tccggtgcag ccaagccctt
     4081 acgacatatg ggccaccgcc gacctggtgg agctggttaa gcagcgcatt gaggtcacgg
     4141 atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat caaaggcacg cgcatcggcg
     4201 gtgaggttgc cgaggcgctg gccgggtacg agctgcccat tcttgagtcc cgtatcacgc
     4261 agcgcgtgag ctacccaggc actgccgccg ccggcacaac cgttcttgaa tcagaacccg
     4321 agggcgacgc tgcccgcgag gtccaggcgc tggccgctga aattaaatca aaactcattt
     4381 gagttaatga ggtaaagaga aaatgagcaa aagcacaaac acgctaagtg ccggccgtcc
     4441 gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg gcagacacgc cagccatgaa
     4501 gcgggtcaac tttcagttgc cggcggagga tcacaccaag ctgaagatgt acgcggtacg
     4561 ccaaggcaag accattaccg agctgctatc tgaatacatc gcgcagctac cagagtaaat
     4621 gagcaaatga ataaatgagt agatgaattt tagcggctaa aggaggcggc atggaaaatc
     4681 aagaacaacc aggcaccgac gccgtggaat gccccatgtg tggaggaacg ggcggttggc
     4741 caggcgtaag cggctgggtt gtctgccggc cctgcaatgg cactggaacc cccaagcccg
     4801 aggaatcggc gtgagcggtc gcaaaccatc cggcccggta caaatcggcg cggcgctggg
     4861 tgatgacctg gtggagaagt tgaaggccgc gcaggccgcc cagcggcaac gcatcgaggc
     4921 agaagcacgc cccggtgaat cgtggcaagc ggccgctgat cgaatccgca aagaatcccg
     4981 gcaaccgccg gcagccggtg cgccgtcgat taggaagccg cccaagggcg acgagcaacc
     5041 agattttttc gttccgatgc tctatgacgt gggcacccgc gatagtcgca gcatcatgga
     5101 cgtggccgtt ttccgtctgt cgaagcgtga ccgacgagct ggcgaggtga tccgctacga
     5161 gcttccagac gggcacgtag aggtttccgc agggccggcc ggcatggcca gtgtgtggga
     5221 ttacgacctg gtactgatgg cggtttccca tctaaccgaa tccatgaacc gataccggga
     5281 agggaaggga gacaagcccg gccgcgtgtt ccgtccacac gttgcggacg tactcaagtt
     5341 ctgccggcga gccgatggcg gaaagcagaa agacgacctg gtagaaacct gcattcggtt
     5401 aaacaccacg cacgttgcca tgcagcgtac gaagaaggcc aagaacggcc gcctggtgac
     5461 ggtatccgag ggtgaagcct tgattagccg ctacaagatc gtaaagagcg aaaccgggcg
     5521 gccggagtac atcgagatcg agctagctga ttggatgtac cgcgagatca cagaaggcaa
     5581 gaacccggac gtgctgacgg ttcaccccga ttactttttg atcgatcccg gcatcggccg
     5641 ttttctctac cgcctggcac gccgcgccgc aggcaaggca gaagccagat ggttgttcaa
     5701 gacgatctac gaacgcagtg gcagcgccgg agagttcaag aagttctgtt tcaccgtgcg
     5761 caagctgatc gggtcaaatg acctgccgga gtacgatttg aaggaggagg cggggcaggc
     5821 tggcccgatc ctagtcatgc gctaccgcaa cctgatcgag ggcgaagcat ccgccggttc
     5881 ctaatgtacg gagcagatgc tagggcaaat tgccctagca ggggaaaaag gtcgaaaagg
     5941 tctctttcct gtggatagca cgtacattgg gaacccaaag ccgtacattg ggaaccggaa
     6001 cccgtacatt gggaacccaa agccgtacat tgggaaccgg tcacacatgt aagtgactga
     6061 tataaaagag aaaaaaggcg atttttccgc ctaaaactct ttaaaactta ttaaaactct
     6121 taaaacccgc ctggcctgtg cataactgtc tggccagcgc acagccgaag agctgcaaaa
     6181 agcgcctacc cttcggtcgc tgcgctccct acgccccgcc gcttcgcgtc ggcctatcgc
     6241 ggccgctggc cgctcaaaaa tggctggcct acggccaggc aatctaccag ggcgcggaca
     6301 agccgcgccg tcgccactcg accgccggcg cccacatcaa ggcaccctgc ctcgcgcgtt
     6361 tcggtgatga cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc
     6421 tgtaagcgga tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt
     6481 gtcggggcgc agccatgacc cagtcacgta gcgatagcgg agtgtatact ggcttaacta
     6541 tgcggcatca gagcagattg tactgagagt gcaccatatg cggtgtgaaa taccgcacag
     6601 atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct tcctcgctca ctgactcgct
     6661 gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt
     6721 atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc
     6781 caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga
     6841 gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata
     6901 ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac
     6961 cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg
     7021 taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc
     7081 cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag
     7141 acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt
     7201 aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt
     7261 atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg
     7321 atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac
     7381 gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca
     7441 gtggaacgaa aactcacgtt aagggatttt ggtcatgcat tctaggtact aaaacaattc
     7501 atccagtaaa atataatatt ttattttctc ccaatcaggc ttgatcccca gtaagtcaaa
     7561 aaatagctcg acatactgtt cttccccgat atcctccctg atcgaccgga cgcagaaggc
     7621 aatgtcatac cacttgtccg ccctgccgct tctcccaaga tcaataaagc cacttacttt
     7681 gccatctttc acaaagatgt tgctgtctcc caggtcgccg tgggaaaaga caagttcctc
     7741 ttcgggcttt tccgtcttta aaaaatcata cagctcgcgc ggatctttaa atggagtgtc
     7801 ttcttcccag ttttcgcaat ccacatcggc cagatcgtta ttcagtaagt aatccaattc
     7861 ggctaagcgg ctgtctaagc tattcgtata gggacaatcc gatatgtcga tggagtgaaa
     7921 gagcctgatg cactccgcat acagctcgat aatcttttca gggctttgtt catcttcata
     7981 ctcttccgag caaaggacgc catcggcctc actcatgagc agattgctcc agccatcatg
     8041 ccgttcaaag tgcaggacct ttggaacagg cagctttcct tccagccata gcatcatgtc
     8101 cttttcccgt tccacatcat aggtggtccc tttataccgg ctgtccgtca tttttaaata
     8161 taggttttca ttttctccca ccagcttata taccttagca ggagacattc cttccgtatc
     8221 ttttacgcag cggtattttt cgatcagttt tttcaattcc ggtgatattc tcattttagc
     8281 catttattat ttccttcctc ttttctacag tatttaaaga taccccaaga agctaattat
     8341 aacaagacga actccaattc actgttcctt gcattctaaa accttaaata ccagaaaaca
     8401 gctttttcaa agttgttttc aaagttggcg tataacatag tatcgacgga gccgattttg
     8461 aaaccgcggt gatcacaggc agcaacgctc tgtcatcgtt acaatcaaca tgctaccctc
     8521 cgcgagatca tccgtgtttc aaacccggca gcttagttgc cgttcttccg aatagcatcg
     8581 gtaacatgag caaagtctgc cgccttacaa cggctctccc gctgacgccg tcccggactg
     8641 atgggctgcc tgtatcgagt ggtgattttg tgccgagctg ccggtcgggg agctgttggc
     8701 tggctggtgg caggatatat tgtggtgtaa acaaattgac gcttagacaa cttaataaca
     8761 cattgcggac gtttttaatg tactgaatta acgccgaatt aattcggggg atctggattt
     8821 tagtactgga ttttggtttt aggaattaga aattttattg atagaagtat tttacaaata
     8881 caaatacata ctaagggttt cttatatgct caacacatga gcgaaaccct ataggaaccc
     8941 taattccctt atctgggaac tactcacaca ttattatgga gaaactcgag cttgtcgatc
     9001 gacagatccg gtcggcatct actctatttc tttgccctcg gacgagtgct ggggcgtcgg
     9061 tttccactat cggcgagtac ttctacacag ccatcggtcc agacggccgc gcttctgcgg
     9121 gcgatttgtg tacgcccgac agtcccggct ccggatcgga cgattgcgtc gcatcgaccc
     9181 tgcgcccaag ctgcatcatc gaaattgccg tcaaccaagc tctgatagag ttggtcaaga
     9241 ccaatgcgga gcatatacgc ccggagtcgt ggcgatcctg caagctccgg atgcctccgc
     9301 tcgaagtagc gcgtctgctg ctccatacaa gccaaccacg gcctccagaa gaagatgttg
     9361 gcgacctcgt attgggaatc cccgaacatc gcctcgctcc agtcaatgac cgctgttatg
     9421 cggccattgt ccgtcaggac attgttggag ccgaaatccg cgtgcacgag gtgccggact
     9481 tcggggcagt cctcggccca aagcatcagc tcatcgagag cctgcgcgac ggacgcactg
     9541 acggtgtcgt ccatcacagt ttgccagtga tacacatggg gatcagcaat cgcgcatatg
     9601 aaatcacgcc atgtagtgta ttgaccgatt ccttgcggtc cgaatgggcc gaacccgctc
     9661 gtctggctaa gatcggccgc agcgatcgca tccatagcct ccgcgaccgg ttgtagaaca
     9721 gcgggcagtt cggtttcagg caggtcttgc aacgtgacac cctgtgcacg gcgggagatg
     9781 caataggtca ggctctcgct aaactcccca atgtcaagca cttccggaat cgggagcgcg
     9841 gccgatgcaa agtgccgata aacataacga tctttgtaga aaccatcggc gcagctattt
     9901 acccgcagga catatccacg ccctcctaca tcgaagctga aagcacgaga ttcttcgccc
     9961 tccgagagct gcatcaggtc ggagacgctg tcgaactttt cgatcagaaa cttctcgaca
    10021 gacgtcgcgg tgagttcagg ctttttcata tctcattgcc ccccgggatc tgcgaaagct
    10081 cgagagagat agatttgtag agagagactg gtgatttcag cgtgtcctct ccaaatgaaa
    10141 tgaacttcct tatatagagg aaggtcttgc gaaggatagt gggattgtgc gtcatccctt
    10201 acgtcagtgg agatatcaca tcaatccact tgctttgaag acgtggttgg aacgtcttct
    10261 ttttccacga tgctcctcgt gggtgggggt ccatctttgg gaccactgtc ggcagaggca
    10321 tcttgaacga tagcctttcc tttatcgcaa tgatggcatt tgtaggtgcc accttccttt
    10381 tctactgtcc ttttgatgaa gtgacagata gctgggcaat ggaatccgag gaggtttccc
    10441 gatattaccc tttgttgaaa agtctcaata gccctttggt cttctgagac tgtatctttg
    10501 atattcttgg agtagacgag agtgtcgtgc tccaccatgt tatcacatca atccacttgc
    10561 tttgaagacg tggttggaac gtcttctttt tccacgatgc tcctcgtggg tgggggtcca
    10621 tctttgggac cactgtcggc agaggcatct tgaacgatag cctttccttt atcgcaatga
    10681 tggcatttgt aggtgccacc ttccttttct actgtccttt tgatgaagtg acagatagct
    10741 gggcaatgga atccgaggag gtttcccgat attacccttt gttgaaaagt ctcaatagcc
    10801 ctttggtctt ctgagactgt atctttgata ttcttggagt agacgagagt gtcgtgctcc
    10861 accatgttgg caagctgctc tagccaatac gcaaaccgcc tctccccgcg cgttggccga
    10921 ttcattaatg cagctggcac gacaggtttc ccgactggaa agcgggcagt gagcgcaacg
    10981 caattaatgt gagttagctc actcattagg caccccaggc tttacacttt atgcttccgg
    11041 ctcgtatgtt gtgtggaatt gtgagcggat aacaatttca cacaggaaac agctatgacc
    11101 atgattacga attcgagctc ggtacccggg gatcctctag agtcgacctg caggcatgca
    11161 agcttggcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa
    11221 cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga agaggcccgc
    11281 accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatgctagag cagcttgagc
    11341 ttggatcaga ttgtcgtttc ccgccttcag tttagcttca tggagtcaaa gattcaaata
    11401 gaggacctaa cagaactcgc cgtaaagact ggcgaacagt tcatacagag tctcttacga
    11461 ctcaatgaca agaagaaaat cttcgtcaac atggtggagc acgacacact tgtctactcc
    11521 aaaaatatca aagatacagt ctcagaagac caaagggcaa ttgagacttt tcaacaaagg
    11581 gtaatatccg gaaacctcct cggattccat tgcccagcta tctgtcactt tattgtgaag
    11641 atagtggaaa aggaaggtgg ctcctacaaa tgccatcatt gcgataaagg aaaggccatc
    11701 gttgaagatg cctctgccga cagtggtccc aaagatggac ccccacccac gaggagcatc
    11761 gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag tggattgatg tgatatctcc
    11821 actgacgtaa gggatgacgc acaatcccac tatccttcgc aagacccttc ctctatataa
    11881 ggaagttcat ttcatttgga gagaacacgg gggactcttg ac




















pSAT6 nCerulean C(A+)








pGreen 0029













