




pCambia 2201载体基本信息

载体名称:pCambia2201, pCambia 2201
载体大小:11786 bp
5' 测序引物及序列:35S promoter: CTATCCTTCGCAAGACCCTTC
3' 测序引物及序列:--

pCambia 2201载体质粒图谱和多克隆位点信息

pCambia 2201载体序列

LOCUS       pCambia2201          11786 bp ds-DNA    circular SYN  
DEFINITION  Agrobacterium binary vector for plant transformation, with 
            kanamycin- and chloramphenicol-resistance and GUS genes.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
COMMENT     This file is created by Vector NTI
COMMENT     The GenBank record was corrected by inserting a G at position 4743.
FEATURES             Location/Qualifiers
     source          1..11786
                     /organism="synthetic DNA construct"
                     /lab_host="Plant Cell"
                     /mol_type="other DNA"
     CDS             join(2..16,207..2024)
                     /label="This version of the gusA gene has a 5' extension 
                     with a catalase intron to ensure expression in plants but 
                     not bacteria."
     intron          17..206
                     /label="cat1 intron"
                     /label="castor bean catalase intron, modified"
     CDS             2031..2048
                     /product="6xHis affinity tag"
     terminator      2083..2335
                     /label="NOS terminator"
                     /label="nopaline synthase terminator and poly(A) signal"
     misc_feature    2357..2381
                     /label="RB T-DNA repeat"
                     /label="right border repeat from nopaline C58 T-DNA"
     CDS             3681..4310
                     /product="stability protein from Pseudomonas plasmid pVS1"
                     /label="pVS1 StaA"
     CDS             4739..5812
                     /product="replication protein from Pseudomonas plasmid 
                     /label="pVS1 RepA"
     misc_feature    6416..6556
                     /label="basis of mobility region from pBR322"
     rep_origin      complement(6742..7330)
                     /label="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(7601..8260)
                     /product="chloramphenicol acetyltransferase"
                     /label="confers resistance to chloramphenicol"
     misc_feature    8788..8812
                     /label="LB T-DNA repeat"
                     /label="left border repeat from nopaline C58 T-DNA"
     polyA_signal    8890..9064
                     /label="CaMV poly(A) signal"
                     /label="cauliflower mosaic virus polyadenylation signal"
     CDS             complement(9121..9918)
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /label="confers resistance to neomycin, kanamycin, and G418 
     promoter        complement(9981..10658)
                     /label="CaMV 35S promoter (enhanced)"
                     /label="cauliflower mosaic virus 35S promoter with a 
                     duplicated enhancer region"
     promoter        10885..10915
                     /label="lac promoter"
                     /label="promoter for the E. coli lac operon"
     protein_bind    10923..10939
                     /bound_moiety="lac repressor encoded by lacI"
                     /label="lac operator"
                     /label="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     10947..10963
                     /label="M13 rev"
                     /label="common sequencing primer, one of multiple similar 
     CDS             10959..11192
                     /gene="lacZ (truncated)"
                     /product="LacZ-alpha fragment of?beta-galactosidase"
     misc_feature    10973..11029
                     /label="pUC18/19 multiple cloning site"
     primer_bind     complement(11033..11049)
                     /label="M13 fwd"
                     /label="common sequencing primer, one of multiple similar 
     promoter        11426..11771
                     /label="CaMV 35S promoter"
                     /label="strong constitutive promoter from cauliflower mosaic
        1 catggtagat ctgagggtaa atttctagtt tttctccttc attttcttgg ttaggaccct
       61 tttctctttt tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga
      121 ttggttatgg tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt
      181 gtctatgatg atgatgatag ttacagaacc gacgactcgt ccgtcctgta gaaaccccaa
      241 cccgtgaaat caaaaaactc gacggcctgt gggcattcag tctggatcgc gaaaactgtg
      301 gaattgatca gcgttggtgg gaaagcgcgt tacaagaaag ccgggcaatt gctgtgccag
      361 gcagttttaa cgatcagttc gccgatgcag atattcgtaa ttatgcgggc aacgtctggt
      421 atcagcgcga agtctttata ccgaaaggtt gggcaggcca gcgtatcgtg ctgcgtttcg
      481 atgcggtcac tcattacggc aaagtgtggg tcaataatca ggaagtgatg gagcatcagg
      541 gcggctatac gccatttgaa gccgatgtca cgccgtatgt tattgccggg aaaagtgtac
      601 gtatcaccgt ttgtgtgaac aacgaactga actggcagac tatcccgccg ggaatggtga
      661 ttaccgacga aaacggcaag aaaaagcagt cttacttcca tgatttcttt aactatgccg
      721 gaatccatcg cagcgtaatg ctctacacca cgccgaacac ctgggtggac gatatcaccg
      781 tggtgacgca tgtcgcgcaa gactgtaacc acgcgtctgt tgactggcag gtggtggcca
      841 atggtgatgt cagcgttgaa ctgcgtgatg cggatcaaca ggtggttgca actggacaag
      901 gcactagcgg gactttgcaa gtggtgaatc cgcacctctg gcaaccgggt gaaggttatc
      961 tctatgaact cgaagtcaca gccaaaagcc agacagagtc tgatatctac ccgcttcgcg
     1021 tcggcatccg gtcagtggca gtgaagggcc aacagttcct gattaaccac aaaccgttct
     1081 actttactgg ctttggtcgt catgaagatg cggacttacg tggcaaagga ttcgataacg
     1141 tgctgatggt gcacgaccac gcattaatgg actggattgg ggccaactcc taccgtacct
     1201 cgcattaccc ttacgctgaa gagatgctcg actgggcaga tgaacatggc atcgtggtga
     1261 ttgatgaaac tgctgctgtc ggctttcagc tgtctttagg cattggtttc gaagcgggca
     1321 acaagccgaa agaactgtac agcgaagagg cagtcaacgg ggaaactcag caagcgcact
     1381 tacaggcgat taaagagctg atagcgcgtg acaaaaacca cccaagcgtg gtgatgtgga
     1441 gtattgccaa cgaaccggat acccgtccgc aaggtgcacg ggaatatttc gcgccactgg
     1501 cggaagcaac gcgtaaactc gacccgacgc gtccgatcac ctgcgtcaat gtaatgttct
     1561 gcgacgctca caccgatacc atcagcgatc tctttgatgt gctgtgcctg aaccgttatt
     1621 acggatggta tgtccaaagc ggcgatttgg aaacggcaga gaaggtactg gaaaaagaac
     1681 ttctggcctg gcaggagaaa ctgcatcagc cgattatcat caccgaatac ggcgtggata
     1741 cgttagccgg gctgcactca atgtacaccg acatgtggag tgaagagtat cagtgtgcat
     1801 ggctggatat gtatcaccgc gtctttgatc gcgtcagcgc cgtcgtcggt gaacaggtat
     1861 ggaatttcgc cgattttgcg acctcgcaag gcatattgcg cgttggcggt aacaagaaag
     1921 ggatcttcac tcgcgaccgc aaaccgaagt cggcggcttt tctgctgcaa aaacgctgga
     1981 ctggcatgaa cttcggtgaa aaaccgcagc agggaggcaa acaagctagc caccaccacc
     2041 accaccacgt gtgaattaca ggtgaccagc tcgaatttcc ccgatcgttc aaacatttgg
     2101 caataaagtt tcttaagatt gaatcctgtt gccggtcttg cgatgattat catataattt
     2161 ctgttgaatt acgttaagca tgtaataatt aacatgtaat gcatgacgtt atttatgaga
     2221 tgggttttta tgattagagt cccgcaatta tacatttaat acgcgataga aaacaaaata
     2281 tagcgcgcaa actaggataa attatcgcgc gcggtgtcat ctatgttact agatcgggaa
     2341 ttaaactatc agtgtttgac aggatatatt ggcgggtaaa cctaagagaa aagagcgttt
     2401 attagaataa cggatattta aaagggcgtg aaaaggttta tccgttcgtc catttgtatg
     2461 tgcatgccaa ccacagggtt cccctcggga tcaaagtact ttgatccaac ccctccgctg
     2521 ctatagtgca gtcggcttct gacgttcagt gcagccgtct tctgaaaacg acatgtcgca
     2581 caagtcctaa gttacgcgac aggctgccgc cctgcccttt tcctggcgtt ttcttgtcgc
     2641 gtgttttagt cgcataaagt agaatacttg cgactagaac cggagacatt acgccatgaa
     2701 caagagcgcc gccgctggcc tgctgggcta tgcccgcgtc agcaccgacg accaggactt
     2761 gaccaaccaa cgggccgaac tgcacgcggc cggctgcacc aagctgtttt ccgagaagat
     2821 caccggcacc aggcgcgacc gcccggagct ggccaggatg cttgaccacc tacgccctgg
     2881 cgacgttgtg acagtgacca ggctagaccg cctggcccgc agcacccgcg acctactgga
     2941 cattgccgag cgcatccagg aggccggcgc gggcctgcgt agcctggcag agccgtgggc
     3001 cgacaccacc acgccggccg gccgcatggt gttgaccgtg ttcgccggca ttgccgagtt
     3061 cgagcgttcc ctaatcatcg accgcacccg gagcgggcgc gaggccgcca aggcccgagg
     3121 cgtgaagttt ggcccccgcc ctaccctcac cccggcacag atcgcgcacg cccgcgagct
     3181 gatcgaccag gaaggccgca ccgtgaaaga ggcggctgca ctgcttggcg tgcatcgctc
     3241 gaccctgtac cgcgcacttg agcgcagcga ggaagtgacg cccaccgagg ccaggcggcg
     3301 cggtgccttc cgtgaggacg cattgaccga ggccgacgcc ctggcggccg ccgagaatga
     3361 acgccaagag gaacaagcat gaaaccgcac caggacggcc aggacgaacc gtttttcatt
     3421 accgaagaga tcgaggcgga gatgatcgcg gccgggtacg tgttcgagcc gcccgcgcac
     3481 gtctcaaccg tgcggctgca tgaaatcctg gccggtttgt ctgatgccaa gctggcggcc
     3541 tggccggcca gcttggccgc tgaagaaacc gagcgccgcc gtctaaaaag gtgatgtgta
     3601 tttgagtaaa acagcttgcg tcatgcggtc gctgcgtata tgatgcgatg agtaaataaa
     3661 caaatacgca aggggaacgc atgaaggtta tcgctgtact taaccagaaa ggcgggtcag
     3721 gcaagacgac catcgcaacc catctagccc gcgccctgca actcgccggg gccgatgttc
     3781 tgttagtcga ttccgatccc cagggcagtg cccgcgattg ggcggccgtg cgggaagatc
     3841 aaccgctaac cgttgtcggc atcgaccgcc cgacgattga ccgcgacgtg aaggccatcg
     3901 gccggcgcga cttcgtagtg atcgacggag cgccccaggc ggcggacttg gctgtgtccg
     3961 cgatcaaggc agccgacttc gtgctgattc cggtgcagcc aagcccttac gacatatggg
     4021 ccaccgccga cctggtggag ctggttaagc agcgcattga ggtcacggat ggaaggctac
     4081 aagcggcctt tgtcgtgtcg cgggcgatca aaggcacgcg catcggcggt gaggttgccg
     4141 aggcgctggc cgggtacgag ctgcccattc ttgagtcccg tatcacgcag cgcgtgagct
     4201 acccaggcac tgccgccgcc ggcacaaccg ttcttgaatc agaacccgag ggcgacgctg
     4261 cccgcgaggt ccaggcgctg gccgctgaaa ttaaatcaaa actcatttga gttaatgagg
     4321 taaagagaaa atgagcaaaa gcacaaacac gctaagtgcc ggccgtccga gcgcacgcag
     4381 cagcaaggct gcaacgttgg ccagcctggc agacacgcca gccatgaagc gggtcaactt
     4441 tcagttgccg gcggaggatc acaccaagct gaagatgtac gcggtacgcc aaggcaagac
     4501 cattaccgag ctgctatctg aatacatcgc gcagctacca gagtaaatga gcaaatgaat
     4561 aaatgagtag atgaatttta gcggctaaag gaggcggcat ggaaaatcaa gaacaaccag
     4621 gcaccgacgc cgtggaatgc cccatgtgtg gaggaacggg cggttggcca ggcgtaagcg
     4681 gctgggttgt ctgccggccc tgcaatggca ctggaacccc caagcccgag gaatcggcgt
     4741 gagcggtcgc aaaccatccg gcccggtaca aatcggcgcg gcgctgggtg atgacctggt
     4801 ggagaagttg aaggccgcgc aggccgccca gcggcaacgc atcgaggcag aagcacgccc
     4861 cggtgaatcg tggcaagcgg ccgctgatcg aatccgcaaa gaatcccggc aaccgccggc
     4921 agccggtgcg ccgtcgatta ggaagccgcc caagggcgac gagcaaccag attttttcgt
     4981 tccgatgctc tatgacgtgg gcacccgcga tagtcgcagc atcatggacg tggccgtttt
     5041 ccgtctgtcg aagcgtgacc gacgagctgg cgaggtgatc cgctacgagc ttccagacgg
     5101 gcacgtagag gtttccgcag ggccggccgg catggccagt gtgtgggatt acgacctggt
     5161 actgatggcg gtttcccatc taaccgaatc catgaaccga taccgggaag ggaagggaga
     5221 caagcccggc cgcgtgttcc gtccacacgt tgcggacgta ctcaagttct gccggcgagc
     5281 cgatggcgga aagcagaaag acgacctggt agaaacctgc attcggttaa acaccacgca
     5341 cgttgccatg cagcgtacga agaaggccaa gaacggccgc ctggtgacgg tatccgaggg
     5401 tgaagccttg attagccgct acaagatcgt aaagagcgaa accgggcggc cggagtacat
     5461 cgagatcgag ctagctgatt ggatgtaccg cgagatcaca gaaggcaaga acccggacgt
     5521 gctgacggtt caccccgatt actttttgat cgatcccggc atcggccgtt ttctctaccg
     5581 cctggcacgc cgcgccgcag gcaaggcaga agccagatgg ttgttcaaga cgatctacga
     5641 acgcagtggc agcgccggag agttcaagaa gttctgtttc accgtgcgca agctgatcgg
     5701 gtcaaatgac ctgccggagt acgatttgaa ggaggaggcg gggcaggctg gcccgatcct
     5761 agtcatgcgc taccgcaacc tgatcgaggg cgaagcatcc gccggttcct aatgtacgga
     5821 gcagatgcta gggcaaattg ccctagcagg ggaaaaaggt cgaaaaggtc tctttcctgt
     5881 ggatagcacg tacattggga acccaaagcc gtacattggg aaccggaacc cgtacattgg
     5941 gaacccaaag ccgtacattg ggaaccggtc acacatgtaa gtgactgata taaaagagaa
     6001 aaaaggcgat ttttccgcct aaaactcttt aaaacttatt aaaactctta aaacccgcct
     6061 ggcctgtgca taactgtctg gccagcgcac agccgaagag ctgcaaaaag cgcctaccct
     6121 tcggtcgctg cgctccctac gccccgccgc ttcgcgtcgg cctatcgcgg ccgctggccg
     6181 ctcaaaaatg gctggcctac ggccaggcaa tctaccaggg cgcggacaag ccgcgccgtc
     6241 gccactcgac cgccggcgcc cacatcaagg caccctgcct cgcgcgtttc ggtgatgacg
     6301 gtgaaaacct ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg
     6361 ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag
     6421 ccatgaccca gtcacgtagc gatagcggag tgtatactgg cttaactatg cggcatcaga
     6481 gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat gcgtaaggag
     6541 aaaataccgc atcaggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt
     6601 tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc
     6661 aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa
     6721 aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa
     6781 tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc
     6841 ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc
     6901 cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag
     6961 ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga
     7021 ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc
     7081 gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac
     7141 agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg
     7201 cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca
     7261 aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa
     7321 aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa
     7381 ctcacgttaa gggattttgg tcatgcatga tatatctccc aatttgtgta gggcttatta
     7441 tgcacgctta aaaataataa aagcagactt gacctgatag tttggctgtg agcaattatg
     7501 tgcttagtgc atctaatcgc ttgagttaac gccggcgaag cggcgtcggc ttgaacgaat
     7561 ttctagctag aggatcgcac caataactgc cttaaaaaaa ttacgccccg ccctgccact
     7621 catcgcagta ctgttgtaat tcattaagca ttctgccgac atggaagcca tcacaaacgg
     7681 catgatgaac ctgaatcgcc agcggcatca gcaccttgtc gccttgcgta taatatttgc
     7741 ccattgtgaa aacgggggcg aagaagttgt ccatattggc cacgtttaaa tcaaaactgg
     7801 tgaaactcac ccagggattg gctgagacga aaaacatatt ctcaataaac cctttaggga
     7861 aataggccag gttttcaccg taacacgcca catcttgcga atatatgtgt agaaactgcc
     7921 ggaaatcgtc gtggtattca ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa
     7981 cggtgtaaca agggtgaaca ctatcccata tcaccagctc accgtctttc attgccatac
     8041 ggaactccgg atgagcattc atcaggcggg caagaatgtg aataaaggcc ggataaaact
     8101 tgtgcttatt tttctttacg gtctttaaaa aggccgtaat atccagctga acggtctggt
     8161 tataggtaca ttgagcaact gactgaaatg cctcaaaatg ttctttacga tgccattggg
     8221 atatatcaac ggtggtatat ccagtgattt ttttctccat gatgtttaac tttgttttag
     8281 ggcgactgcc ctgctgcgta acatcgttgc tgctccataa catcaaacat cgacccacgg
     8341 cgtaacgcgc ttgctgcttg gatgcccgag gcatagactg taccccaaaa aaacatgtca
     8401 taacaagaag ccatgaaaac cgccactgcg ccgttaccac cgctgcgttc ggtcaaggtt
     8461 ctggaccagt tgcgtgacgg cagttacgct acttgcatta cagcttacga accgaacgag
     8521 gcttatgtcc actgggttcg tgcccgaatt gatcacaggc agcaacgctc tgtcatcgtt
     8581 acaatcaaca tgctaccctc cgcgagatca tccgtgtttc aaacccggca gcttagttgc
     8641 cgttcttccg aatagcatcg gtaacatgag caaagtctgc cgccttacaa cggctctccc
     8701 gctgacgccg tcccggactg atgggctgcc tgtatcgagt ggtgattttg tgccgagctg
     8761 ccggtcgggg agctgttggc tggctggtgg caggatatat tgtggtgtaa acaaattgac
     8821 gcttagacaa cttaataaca cattgcggac gtttttaatg tactgaatta acgccgaatt
     8881 aattcggggg atctggattt tagtactgga ttttggtttt aggaattaga aattttattg
     8941 atagaagtat tttacaaata caaatacata ctaagggttt cttatatgct caacacatga
     9001 gcgaaaccct ataggaaccc taattccctt atctgggaac tactcacaca ttattatgga
     9061 gaaactcgag cttgtcgatc gactctagct agaggatcga tccgaacccc agagtcccgc
     9121 tcagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat
     9181 accgtaaagc acgaggaagc ggtcagccca ttcgccgcca agctcttcag caatatcacg
     9241 ggtagccaac gctatgtcct gatagcggtc cgccacaccc agccggccac agtcgatgaa
     9301 tccagaaaag cggccatttt ccaccatgat attcggcaag caggcatcgc catgtgtcac
     9361 gacgagatcc tcgccgtcgg gcatgcgcgc cttgagcctg gcgaacagtt cggctggcgc
     9421 gagcccctga tgctcttcgt ccagatcatc ctgatcgaca agaccggctt ccatccgagt
     9481 acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag
     9541 cgtatgcagc cgccgcattg catcagccat gatggatact ttctcggcag gagcaaggtg
     9601 agatgacagg agatcctgcc ccggcacttc gcccaatagc agccagtccc ttcccgcttc
     9661 agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg
     9721 cgctgcctcg tcctggagtt cattcagggc accggacagg tcggtcttga caaaaagaac
     9781 cgggcgcccc tgcgctgaca gccggaacac ggcggcatca gagcagccga ttgtctgttg
     9841 tgcccagtca tagccgaata gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc
     9901 atcttgttca atccccatgg tcgatcgaca gatctgcgaa agctcgagag agatagattt
     9961 gtagagagag actggtgatt tcagcgtgtc ctctccaaat gaaatgaact tccttatata
    10021 gaggaaggtc ttgcgaagga tagtgggatt gtgcgtcatc ccttacgtca gtggagatat
    10081 cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc
    10141 tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga ggcatcttga acgatagcct
    10201 ttcctttatc gcaatgatgg catttgtagg tgccaccttc cttttctact gtccttttga
    10261 tgaagtgaca gatagctggg caatggaatc cgaggaggtt tcccgatatt accctttgtt
    10321 gaaaagtctc aatagccctt tggtcttctg agactgtatc tttgatattc ttggagtaga
    10381 cgagagtgtc gtgctccacc atgttatcac atcaatccac ttgctttgaa gacgtggttg
    10441 gaacgtcttc tttttccacg atgctcctcg tgggtggggg tccatctttg ggaccactgt
    10501 cggcagaggc atcttgaacg atagcctttc ctttatcgca atgatggcat ttgtaggtgc
    10561 caccttcctt ttctactgtc cttttgatga agtgacagat agctgggcaa tggaatccga
    10621 ggaggtttcc cgatattacc ctttgttgaa aagtctcaat agccctttgg tcttctgaga
    10681 ctgtatcttt gatattcttg gagtagacga gagtgtcgtg ctccaccatg ttggcaagct
    10741 gctctagcca atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt aatgcagctg
    10801 gcacgacagg tttcccgact ggaaagcggg cagtgagcgc aacgcaatta atgtgagtta
    10861 gctcactcat taggcacccc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg
    10921 aattgtgagc ggataacaat ttcacacagg aaacagctat gaccatgatt acgaattcga
    10981 gctcggtacc cggggatcct ctagagtcga cctgcaggca tgcaagcttg gcactggccg
    11041 tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat cgccttgcag
    11101 cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc
    11161 aacagttgcg cagcctgaat ggcgaatgct agagcagctt gagcttggat cagattgtcg
    11221 tttcccgcct tcagtttagc ttcatggagt caaagattca aatagaggac ctaacagaac
    11281 tcgccgtaaa gactggcgaa cagttcatac agagtctctt acgactcaat gacaagaaga
    11341 aaatcttcgt caacatggtg gagcacgaca cacttgtcta ctccaaaaat atcaaagata
    11401 cagtctcaga agaccaaagg gcaattgaga cttttcaaca aagggtaata tccggaaacc
    11461 tcctcggatt ccattgccca gctatctgtc actttattgt gaagatagtg gaaaaggaag
    11521 gtggctccta caaatgccat cattgcgata aaggaaaggc catcgttgaa gatgcctctg
    11581 ccgacagtgg tcccaaagat ggacccccac ccacgaggag catcgtggaa aaagaagacg
    11641 ttccaaccac gtcttcaaag caagtggatt gatgtgatat ctccactgac gtaagggatg
    11701 acgcacaatc ccactatcct tcgcaagacc cttcctctat ataaggaagt tcatttcatt
    11761 tggagagaac acgggggact cttgac




















pSAT6 nCerulean C(A+)








pGreen 0029












